Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15026H9
Clone ID IST15026H9
Vector VICTR78
Project tigm

Sequence tag IST15026H9HMR1
Sequence
NNNNNANNANNANNNNNNNGNGGTNNTNNCGGATGAAACAAGGCCNTGGTACCTGGAGCATAAAGTGGAAGGTANAAAAC
AAACAAAGAAAACNGAANACNNCTTCAAAAAATTTTATTCTAAGTAAGGTAGAAGCTGTTGGAGAATCTTAAGCTAGGTA
TTTACATAGTTTTAAAAACATTTCAGCACCAAGTGCTGTGACACACACCTTTNATCCCAGCACTTGGGAGGCAGAGGAAG
GCAGATCTTTGANNTCN
Sequence Type genomic DNA
Unitrap ID UNI33060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 146136062..146136284 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028188 (Spata1) NM_027617 spermatogenesis associated 1 Gene [Source:MGI (curated);Acc:Spata1-001]


Sequence tag IST15026H9HMF1
Sequence
CTTAGGGCTAAGGGATAAAGGCTTGACCCCGTAGGTATGGACCCGTATGGACCCATACTCACCCCTCCAACTCTCTCCTC
TCTCTCTCTCTCTCTCCAAACACACATGCCTCTANGAATAAAAAGATCTGGGCCGGATGGANCTTATTTGCTGCNCTTTG
NATGTGTCTGGANGANGAANGTTCTANGTCACCCTCCTTCTGCTACACGTGGCCNNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028188


For any suggestions or comments, please send an email to unitrap@crg.es