Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14392G7
Clone ID IST14392G7
Vector VICTR74
Project tigm

Sequence tag IST14392G7HMR1
Sequence
TTGTTTGTTTTAGGAGGCAAAGTCCTTGCTGACCTGGAACTTCCTTTTGGTGGCCTAGCTGGCTTTGAACTCTGCTTCTG
CCTCTGGCAAGCCATTTGAGTCCACACCCAGCTCTCATTTCCTTCTTGAGGCAGGTCTCACGCTTANCCCAGGCTGCCCT
CAAACACAGTCGGAGTCCTCCTGCCTCANGCTCCCAAGTGCTGGTANAATGGGTGACATCACTGCTCCCANCTGTAAATA
TTTATTTTANAGACTATTGCTATTTCATTATTCN
Sequence Type genomic DNA
Unitrap ID UNI13108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56860331..56860603 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


Sequence tag IST14392G7BBF1
Sequence
AAACAAACAAACAAACACACACACACACACAAAACAAACCAGCAAGCAAGCAGCGGAACACAGGGTGGATACACAGGTAC
CTGCTTGCTTGGCTTCNATGCANGCGATGTTAATTTCTTCTTTCAAATCCCANTTTTCGTTGGCTATAGCTTCCCCTACT
TTAACAAATCTTCCAACTGCCAAGTTGACCGCTTGTCCCACACGCTGAATCGCTTGCNGGGTTTTATCANACTTTTTGGT
ATTATCTTTATGGTTTATAAGTGTGGTGATCTGAAAATTAAAAAAAAAANAANAAAAAAAAAAAAANNCTTTNACCTNAA
TNCNNAAAAATAAATAAANAAATAANACTTTAAAAAANATNTCACAAANACNAAGAAAATTAACCCCAGCATATCANACC
AAGCAAATCNTTCNCNNTANACCTNGCANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14392G7HMF1
Sequence
AAACAAACAAACAAACACACACACACACACAAAACAAACCANCAAGCAAGCANCGGAACACANGGTGGATACACAGGTAC
CTGCTTGCTTGGCTTCNATGCANGCGATGTTAATTTCTTCTTTCAAATCCCANTTTTCGTTGGCTATAGCTTCCCCTACT
TTAACAAATCTTCCAACTGCCAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56860602..56860787 174
 
EST/CDNA Est Name
  CN536427.1

 
Come back to gene CN536427.1


For any suggestions or comments, please send an email to unitrap@crg.es