Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12099G4
Clone ID IST12099G4
Vector VICTR76
Project tigm

Sequence tag IST12099G4BBF1
Sequence
GGGTTGCAGTGTTCCTAAGGGAGGGCATCCAATTTTGATTTTGTTGCTGTTGTTGTTGTTTCTGTTGTTTGTTTTTGAGA
CAGGATCTCTCTGAGGCTAGCCTCAGACTCCCAGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI2830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66545609..66545729 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]

 
Come back to gene ENSMUSG00000019873


For any suggestions or comments, please send an email to unitrap@crg.es