Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10358C6
Clone ID IST10358C6
Vector VICTR76
Project tigm

Sequence tag IST10358C6BBF1
Sequence
AGGACAGTGATTGTAGGTTTCCCCTGAAGTTTTTGCTAATGTTGCATTACTCGATCATGAATGGCCCCTTGCTATGTCTT
GGTCTTCTGACCTCTTTCCTAGTTTACTAATCTCCGTGCCTGGCAGATTTCCCTGACAAGGAGCCATAGTGGCTTTCTCT
TTTATAGAGGCTTGCTGCCTCCTTCATGTGACCCCGCAATCTTCAGCTAGGGCAGTTGTGGAGACAGGGTTTGATTGTTG
TGATTGCAGTGCTATCTGCATCTAGTGGGGAGAGGCCNNNNATCCTGTTAAATGTTCTNTAATGTGCTGAACAGCCCCCA
CAGCACAGGCTANCCANCTNANAGTAACAACATCGAAACAAANGAACCCTGCACCGACTGGTACGCCCTGCTTTGTCTNA
TTCAAGCCCTGANAACCTGAATTTGATACCTGGAATCCACGTGGTGGAANGANGGAACCTGCACCCTCAANCCATNCTNN
GNTTTCCGTGCNCACGCAGAAGNNNNNGTGGGCGTTGGGCGTGGGGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10358C6HMF1
Sequence
AGGACAGTGATTGTAGGTTTCCCCTGAAGTTTTTGCTAATGTTGCATTACTCGATCATGAATGGCCCCTTGCTATGTCTT
GGTCTTCTGACCTCTTTCCTAGTTTACTAATCTCCGTGCCTGGCAGATTTCCCTGACAAGGAGCCATAGTGGCTTTCTCT
TTTATAGAGGCTTGCTGCCTCCTTCATGTGACCCCGCAATCTTCAGCTAGGGCAGTTGTGGAGACAGGGTTTGATTGTTG
TGATTGCAGTGCTATCTGCATCTANTGGGGAGAGGCCNNNNATCCTGTTAAATGTTCTGTAATGTGCTGAACAGCCCCCA
CAGCACAGGCTANCCANCTNAGAGTAACAACATCGAAACAAAGGANCCCTGCACCGACTGGTACGCCCTGCTTTGTCTNA
TTCAAGCCCTGATAACCTGAATTNGATACN
Sequence Type genomic DNA
Unitrap ID UNI4828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95074832..95075260 407
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015711 (Prune) NM_173347 prune homolog (Drosophila) Gene [Source:MGI (curated);Acc:Prune-001]

 
Come back to gene ENSMUSG00000015711


For any suggestions or comments, please send an email to unitrap@crg.es