Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A026B08
Clone ID A026B08
Vector pT1betageo
Project ggtc

Sequence tag A026B08
Sequence
GGTTCTGTGAAGAGACGTGGGGAAGATTCGATTCCGAGAAAAGGAAAAGCCGGATTGAAAGGGAGCGAACCCGCTGAGGG
GGAGGGGGCTGCCAAGATGGCGTCCGCCTCCTCAGGGCCAGCGGCGGCCGGGTTTTTATCCCTTGATCCCGGGGCCCCTG
CTGGTACCGCAG
Sequence Type mRNA
Unitrap ID UNI5111

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94910298..94910469 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028126 (Pip5k1a) NM_008847 phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha Gene [Source:MGI (curated);Acc:Pip5k1a-002]

 
Come back to gene ENSMUSG00000028126


For any suggestions or comments, please send an email to unitrap@crg.es