Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12687C1
Clone ID IST12687C1
Vector VICTR76
Project tigm

Sequence tag IST12687C1HMF1
Sequence
GTGGCTCGTGTGTGTGATCGAGGGGAACGGAGCCACAAGCAGATAGCCTAAGCAAACCAGTGGCCGGGATAGCTGAATCA
CAGCATAAAAACCAGTGAAATGTGCTGCGAGTCACCAGCCTTAAGGAAATCAGATCCTGAACTATGGAACATAAAGGAAT
CTTAATTTTGTTTGAAAAGCACAAGGTGGAGTTAAAATCTTTAGGAAGAAGTGATTTCTTTTGTTTATATACTATGCTGT
CCCCTTGGTGAAGAAGACATGTTATTTAAAGGAGGAAAAATTACACTATTGACACATTTCTTGTTGGAACACAGTTTGTT
AAAGCACAAAATGCCNCGTGGCTCCGGTCACNCCTTGNCAATTTNNNTNNNANNNNNNNTTANAGGTTGTGNNGNAN
Sequence Type genomic DNA
Unitrap ID UNI11231

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 71695400..71695763 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026193 (Fn1) NM_010233 fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]


Sequence tag IST12687C1BBF1
Sequence
GTGGCTCGTGTGTGTGATCGAGGGGAACGGAGCCACAAGCAGATAGCCTAAGCAAACCAGTGGCCGGGATAGCTGAATCA
CAGCATAAAAACCAGTGAAATGTGCTGCGAGTCACCAGCCTTAAGGAAATCAGATCCTGAACTATGGAACATAAAGGAAT
CTTAATTTTGTTTGAAAAGCACAAGGTGGAGTTAAAATCTTTANGAANAANTGATTTCTTTTGTTTATNTNCTANGCTGT
CCCCTTGGTGNNNANNACNTGTTNNTTNNNGNNGNNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000026193


For any suggestions or comments, please send an email to unitrap@crg.es