Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10059D6
Clone ID IST10059D6
Vector VICTR75
Project tigm

Sequence tag IST10059D6BBR1
Sequence
CATTACTATTCCAAAAGGGAGAAAACAGCACAATGAGGAAGTACTGGATGAGAATAAGACCAAAAACTTCAAATTCTGTA
TCTCCCATGTTTGGTGTCAAAGTGCTCTTCAGATCC
Sequence Type genomic DNA
Unitrap ID UNI1243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60649024..60649138 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042569 (Dhrs7b) NM_145428 dehydrogenase/reductase (SDR family) member 7B Gene [Source:MGI (curated);Acc:Dhrs7b-001]


Sequence tag IST10059D6HMF1
Sequence
AATGTATATCCTTTGCCCTTGCAAGTTGGAAGTGTGCGATCTGCTTATTGGAGCCAGAGAGTAGAATGTGGTGGTTTGAA
TGAGAATGTCTGCCACAGGCTCACAGATCTGAATACTTAGTCACCACAGAGTGGTACTATTTAAAAGGATTAGGAAGTGT
GGCCTTGTTGGAGGAAGTATGTCATGGGGCAGGCGTGTGTGTGTGTGTGTGTGTGTAACTGATATTTCAAAAAGCCCATT
CTAAGCCCAGACTCTCTCTCTTGCTGCTGCCACCATACTACTCCCTGCCATGATGATAATGAACTATATCTCTAACACTG
TAAGCCACCCCCAATTAAATACTTCCTTTTATAAGAGTTGCTGTGGGCCGCCCGGGCAGTGGTGGCTCACGCCTTTGATC
CTAGCACTTGAGAGGCAGACGCGCGCAGATTCTGAGTTCAGCGCCAGTCTGCTCTACAGAGTGAGTTCCAACACTCACAG
AGGGTGGCATATAACCTCTGTAAGGGGATCTGATGCCCTCTTCTGTCTTCTGGTGTGTCTAGAGACAGCAACTGTGTACT
CACATATAAGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60648456..60649027 528
NO GENE  

 
Come back to gene ENSMUSG00000042569


For any suggestions or comments, please send an email to unitrap@crg.es