Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10921B9
Clone ID IST10921B9
Vector VICTR76
Project tigm

Sequence tag IST10921B9HMR1
Sequence
TCTCAAAAACCNAAAGTGGTGGTTGGGGGTCGGGGGATATAAAGGAGACAATTATTTTGTGTGTATGCNTGTACCACAGC
CTGCTCTGAAGGTCANAGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI5870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101493662..101493763 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]


Sequence tag IST10921B9BBF1
Sequence
GAGACAGAGGAGTGGAATATGATGGTTTATATATGCTCAGCCCAGGAAGTGGCACTATTANGTCTACCCTGGTTGGAGAA
GACGTGGCCTTGTTGGAGGTGTGTCCCTGTGACTGTGGGCTTTAAGACCTTCATGTTGATAATCCTGCATTTTTCACAAA
GCAAACCTNCNNCATGTGATANATTAAAAAAAACAAAACAAAACCCAAAGCCAGTANCACTGAATGAACACTACAAACTC
TACAAAGCANNGNNNNNTNCNAAANACATTTTGTTCCTTATACTTTATACNANGGCTGGAAAATTCTCTAACTGTATACT
GCGGGGCAGTTGCCCANGGGGAATAAAGGGAGTGGGACAAANCATGGAGTCCTGCNANAGTTTNNGTGTTTTGGCCAGAG
ATAACAGGTTTTNANTCCCNNNCNTCCCANAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10921B9HMF1
Sequence
GAGACAGAGGAGTGGAATATGATGGTTTATATATGCTCAGCCCAGGAAGTGGCACTATTANGTCTACCCTGGTTGGAGAA
GACGTGGCCTTGTTGGAGGTGTGTCCCTGTGACTGTGGGCTTTAAGACCTTCATGTTGATAATCCTGCATTTTTCACAAA
GCAAACCTACNACATGTGATANATTAAAAAAAACAAAACAAAACCCAAAGCCAGTANCACTGAATGAACACTACAAACTC
TACAAAGCANTGGGCNTCCCAAANACATTTTGTTCCTTATACTTTATACNANGGCTGGAAAATTCTCTAACTGTATACTG
CGGGGCAGTTGCCCAGGGGGAATAAAGGGAGTGGGACAAAACATGGAGTCCTGCCANANTTTNNNTGTTTTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101493760..101494152 365
 
EST/CDNA Est Name
  BF161117.1 - CN672700.1 - BE303202.1 - CF616843.1 - CF158370.1 - CA537307.1 - CA548709.1 - BY094824.1 - DV055948.1 - BE374705.1 - BE860684.1 - CA556494.1 - AW744502.1 - CJ108356.1 - AW610904.1 - CB232240.1 - CA569805.1 - CB235860.1 - AA051744.1 - CF154833

 
Come back to gene BF161117.1 - CN672700.1 - BE303202.1 - CF616843.1 - CF158370.1 - CA537307.1 - CA548709.1 - BY094824.1 - DV055948.1 - BE374705.1 - BE860684.1 - CA556494.1 - AW744502.1 - CJ108356.1 - AW610904.1 - CB232240.1 - CA569805.1 - CB235860.1 - AA051744.1 - CF154833


For any suggestions or comments, please send an email to unitrap@crg.es