Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W094B07
Clone ID W094B07
Vector pT1betageo
Project ggtc

Sequence tag W094B07
Sequence
CTCTCCACATAACTGNNNNGGGGCGGGGGNTNCGTGTGTTCCAAAGGGAGCCATTCCGGAAGTCCCACACTTCCCGAAGT
GTCCGCCACTTCCTAGATCTCTTCATGGAGANNNAGATGTTTGCAGGATTTGTCCAGGACCGGGAGCTTCGGCAAAGCGG
AGTTAAAGGTTTGTTTGAAGTCCGGGCTCTTCAATATTTGGAAACAATTCCTGAGTCGGAACCCAGCGGGGTGAATAGAA
TTTTACGTAGTCTTG
Sequence Type mRNA
Unitrap ID UNI12338

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102969000..102970422 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es