Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15098A3
Clone ID IST15098A3
Vector VICTR80
Project tigm

Sequence tag IST15098A3HMR1
Sequence
CCAGCTATAGGGGATTTCACACCCGCTTCTGGGCACCAGGCATGAACGTAGTGCACAGACATCTCTGTAGGCAAAGTACT
AACAGAAACATAGGAATCTTAGAAATAGTTAAGTGTATGTGGGTATATATCTGGGAGTGCTCGTGCGTGCACACACACAC
AGAGACACCCCCCCCCN
Sequence Type genomic DNA
Unitrap ID UNI30317

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22139492..22139667 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033581 (Igf2bp2) NP_898850 insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI (curated);Acc:Igf2bp2-001]


Sequence tag IST15098A3BBF1
Sequence
GCTGGAGTTTCANATAGTCATGAGATTCCATGTGAGTCCTGGGAACCAAACTGGGTCCTTGGTAACCACTGANCCATCAC
TCCAGTCCCCACCCCAAGCTACTTTTCTAGGGTGCTTTCTCTTGGGGTATGTTTATAGTGTGATATTATGCCTGCTCANC
AAGACCCAACTAAACAAACAACTTTAAGCTTTTCTTTACTAAACTTTCAGGAGGTGGACACTTCAGAGGACAACTGGAAG
TGTGTTCTAAACTTCTGGCCACCCATATCAGTACTGGCTGTTACCTACACAAAGCTGTGCCAGAGCCCAGCCCCCCAANA
TCAGGTGGGCTAAGGTCACTCCCTAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22139663..22140007 337
 
EST/CDNA Est Name
  CJ199139.1 - CJ169368.1 - BU511361.1 - BB855310.1 - BY013235.1 - CJ077157.1 - BB853640.1 - BY007372.1 - CJ074573.1 - CJ085175.1 - CJ083851.1 - BB852457.1 - CJ166753.1 - CJ087644.1 - CJ074764.1 - CJ076290.1 - BB862701.1 - CN529625.1 - BB852318.1 - BY304561


Sequence tag IST15098A3HMF1
Sequence
GCTGGAGTTTCAGATAGTCATGAGATTCCATGTGAGTCCTGGGAACCAAACTGGGTCCTTGGTAACCACTGAGCCATCAC
TCCAGTCCCCACCCCAAGCTACTTTTCTAGGGTGCTTTCTCTTGGGGTATGTTTATAGTGTGATATTATGCCTGCTCAGC
AAGACCCAACTAAACAAACAACTTTAAGCTTTTCTTTACTAAACTTTCAGGAGGTGGACACTTCAGANGACAACTGGAAG
TGTGTTCTAAACTTCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22139663..22139920 256
 
EST/CDNA Est Name
  BY013235.1 - CJ074573.1 - CJ085175.1 - CJ083851.1 - CJ087644.1 - CJ074764.1 - CJ076290.1 - CN529625.1 - BY012060.1 - BY138479.1 - BY306282.1 - BY068095.1 - BY066819.1 - BY143182.1 - CJ072377.1 - BY011900.1 - BY071363.1 - BY093351.1 - BY315714.1 - BY098706

 
Come back to gene BY013235.1 - CJ074573.1 - CJ085175.1 - CJ083851.1 - CJ087644.1 - CJ074764.1 - CJ076290.1 - CN529625.1 - BY012060.1 - BY138479.1 - BY306282.1 - BY068095.1 - BY066819.1 - BY143182.1 - CJ072377.1 - BY011900.1 - BY071363.1 - BY093351.1 - BY315714.1 - BY098706


For any suggestions or comments, please send an email to unitrap@crg.es