Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W061B06
Clone ID W061B06
Vector pT1betageo
Project ggtc

Sequence tag W061B06
Sequence
GCCGAAGATGGCGGAGGGGCAGGTTCTGGTATTGGATGGCCGAGGCCATCTTCTTGGCCGCCTGGCGGCCATTGTGGCCA
AGCAGGTACTTGAGG
Sequence Type mRNA
Unitrap ID UNI1712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52382870..52384091 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003426 (Rpl13a) NM_009438 ribosomal protein L13a Gene [Source:MGI (curated);Acc:Rpl13a-001]

 
Come back to gene ENSMUSG00000003426


For any suggestions or comments, please send an email to unitrap@crg.es