Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14140A3
Clone ID IST14140A3
Vector VICTR74
Project tigm

Sequence tag IST14140A3HMR1
Sequence
CTACCNCTTTCTGTACATTTGACCNTAGAGTTCCATGCATAGCAGATACTCTGTATTGAACTGTGTAAGATGGCTGTATT
TGTAATCAAGGAATGGAACACACCTGTAATCCTAACCCCTTGGGAGACTGAGACAGGAGGATTGCCTGGAATGGCTGGTC
AGCCCGGACTACAGTGTGGGGCCCTGTCTCAAAAGAGCAAAACCAAAGAGTGCTTATAAATAANAACTN
Sequence Type genomic DNA
Unitrap ID UNI12064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28273406..28273633 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008384 (Sertad1) NM_018820 SERTA domain containing 1 Gene [Source:MGI (curated);Acc:Sertad1-001]

 
Come back to gene ENSMUSG00000008384


For any suggestions or comments, please send an email to unitrap@crg.es