Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11278H5
Clone ID IST11278H5
Vector VICTR76
Project tigm

Sequence tag IST11278H5HMF1
Sequence
TGTTCCTTCAAGCAGACAATAAAGGGTGGTTAGTGACCTTCTGTGGGTCATTACTANAGCAGGTGTTGATACACTGTGGT
CCATGAACCACCTCANAGCTATTCCCTTTTTGGA
Sequence Type genomic DNA
Unitrap ID UNI31050

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 57148015..57148127 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022366 (BC026439) NM_172378 BC026439 proteinPutative uncharacterized proteincDNA sequence BC026439 ;; [Source:UniProtKB/TrEMBL;Acc:Q8R0S9]

 
Come back to gene ENSMUSG00000022366


For any suggestions or comments, please send an email to unitrap@crg.es