Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14913D6
Clone ID IST14913D6
Vector VICTR76
Project tigm

Sequence tag IST14913D6HMR1
Sequence
CACCCACCCAGGCTGCTGAGAGCACTGTTGTGTGGAAGGGGCAAGGGAGCCTGTTTCATAGACGAAGAAATGGGGGGCCT
GCCTTGCTAAAGCATCCAGAATCCCTGAGAAGCAGAAACAGAGGTCACGTCTCCAAAAGCCCTGGCCTGGGCTTTGTCCT
CACTGTTAAGAAGTGACACAAGCCAGGCTTGGTGGTGCTTANCTGCAGTAAGTGATCTCTGTGAGTTCAAGGCCAGTCTG
GTCTACAATCCTTTANCCCTGAGTTCCAGGACAGTCNNGGCTCTGTTACACNNNNAAACCTTGTCTCANAAGGAAAAAAA
AAAAN
Sequence Type genomic DNA
Unitrap ID UNI32801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106521629..106521952 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]


Sequence tag IST14913D6HMF1
Sequence
GGTGCAGCTAGGGAAGCTGTTCACCTCATTCCTCTTCGCCTTAAACAGACAGCCTTCATCCCCACAGAGAATGTCAGCGC
CTTCCTGTCTGTCCAGAGCATAATGAGCTCTGTTTAGCAAGAATTCAGACCCAGCAAAACAAAGGAAGCCAGGGCCCCAC
TGAAGGCTACAGAGAAGTCTTGCTGGAAGTTTCTCCCAGACCCAAAAGACCAGTTCAGAGGCCAGTTCCTTATTTTTGAA
GATAATAGCTGCCCTGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106521949..106522209 261
 
EST/CDNA Est Name
  AA867567.1 - W18943.1 - AA462321.1 - CD550246.1


Sequence tag IST14913D6BBF1
Sequence
GGTGCAGCTAGGGAAGCTGTTCACCTCATTCCTCTTCGCCTTAAACAGACAGCCTTCATCCCCACAGAGAATGTCAGCGC
CTTCCTGTCTGTCCAGAGCATAATGAGCTCTGTTTAGCAAGAATTCAGACCCAGCAAAACAAAGGAAGCCAGGGCCCCAC
TGAAGGCTACAGAGAAGTCTTGCTGGAAGTTTCTCCCAGACCCAAAAGACCAGTTCAGAGGCCAGTTCCTTATTTTTGAA
GATAATAGCTGCCCTGTTAACCCCTGTGCTGCTGGGTGCCCACAGACAGGCTGGGAACCGGAAGGCAGTGGGTTATGAAT
GGGTTGAACTTAAACCCCTTCCCTCCCTCCCTCCCTCCCTCCTGAGTTTATTGTACATCCTTTTGTGTGTGTGAGTGTGT
GTGTGTGTGCGCGCGCGCGTGCGTGCGTGCNTNCACATGCCTGTGTANAAATGTTCNTNTGTGAGTGTGTCNGCGTGCAT
AN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106521949..106522429 467
 
EST/CDNA Est Name
  CB587554.1 - CF173393.1 - CF914469.1 - BG080354.2 - CD550310.1 - BU697042.1 - AI510163.1 - BU695300.1 - AA088034.1 - CD742108.1 - AA110123.1 - AA867567.1 - BE289940.1 - DT915366.1 - W18943.1 - AA462321.1 - AI323278.1 - AA124630.1 - CD550246.1 - AU021548.1

 
Come back to gene CB587554.1 - CF173393.1 - CF914469.1 - BG080354.2 - CD550310.1 - BU697042.1 - AI510163.1 - BU695300.1 - AA088034.1 - CD742108.1 - AA110123.1 - AA867567.1 - BE289940.1 - DT915366.1 - W18943.1 - AA462321.1 - AI323278.1 - AA124630.1 - CD550246.1 - AU021548.1


For any suggestions or comments, please send an email to unitrap@crg.es