Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14402F12
Clone ID IST14402F12
Vector VICTR74
Project tigm

Sequence tag IST14402F12HMR1
Sequence
TTAAGAGCAGTCTGTGCTCTTAACCNCTGAGCCATCTCTCCAGCCCCTGAAAAATCATTTCTTAACCCAAGGTCTCAAGC
ATTTTTTTTTTTTTTNANNCN
Sequence Type genomic DNA
Unitrap ID UNI23348

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112253415..112253508 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032745 (Gpbp1) NM_028487 GC-rich promoter binding protein 1 Gene [Source:MGI (curated);Acc:Gpbp1-002]


Sequence tag IST14402F12HMF1
Sequence
TTACAGAGGTCCAGAATTCAAATCCCAGCAAGCACATGGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112253506..112253545 40
NO GENE  

 
Come back to gene ENSMUSG00000032745


For any suggestions or comments, please send an email to unitrap@crg.es