Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14049H8
Clone ID IST14049H8
Vector VICTR74
Project tigm

Sequence tag IST14049H8HMF2
Sequence
CCCTGGCTGTCCTANAACTTACTTTGTAGTAAACCAGTCTGGCCTCGAACTCACAGANATTTGTTACCCTATACCTCCCA
AGTGGGGGGAATACAGGCTTGACTGTACCACCACTGCCTGGCCCTGAGGGGACTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI12836

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7591484..7591624 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031163 (Glod5) NM_027227 glyoxalase domain containing 5 Gene [Source:MGI (curated);Acc:Glod5-001]


Sequence tag IST14049H8BBF1
Sequence
NGGGGANACATAGTGAGACTCTGCCTNACAGAGGGTCAGGAGCCNCACAANANGGGTAAAAACACTTGCTGCCNAGCCTG
GTGAGGCTTGTCTNAAAAAAACAAAAACAAAAAACAAAGAAATTAAACAAAAGTGCATTATTGCCANACAGTANTGGCNC
NNGCCTTTAATCCCAGCACTCGGGGAACANAGGTAGGGANANCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031163


For any suggestions or comments, please send an email to unitrap@crg.es