Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13000H5
Clone ID IST13000H5
Vector VICTR76
Project tigm

Sequence tag IST13000H5HMR1
Sequence
NCTCTGCTCTNACTCACCTTTTGCTGAGAGTTTTACTCCTTGATTCTAATTTGCAATCTGGACTTCAGGTGTTTTTAATG
GACCCCCTTAACTCTTTGCCTCCCACATCCTCTTGAGGGCCATCCCTCCTCCCTTTGTGCTGCCCTCTCACTTGGGCCAG
TCCTATCTTTGCTGTGTCATAGCTTCTACATTTCCTTCCCTCTTCTTTTTTGTATTTCATAGTCAGTGAGGGCAGTGCTA
TACTAATCCCTAAACCCTCCAACAGACGTATTGGCCTAATGCCACTTTACAGTGCTTTCTTCCAAGGAGAGTCTTCATGC
AGCAGGAGTTCTGATCTGAAGGGTGACATTTAGTGAGCATCCCCTGTTTTGAGGCCCAGCCTTGCCACCATGTCCCTACA
TGGCCTGGCATCTGTGGCTTGATGATATCCACACGCTCTANATGTTGATCANGGGCANTCTCTAGCTTTATGANNGAGAN
AGANAGAGAGAGAGAGAGAGANAGAGANNNANNNANNNAN
Sequence Type genomic DNA
Unitrap ID UNI33074

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121382026..121382531 488
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039230 (Tbcd) NM_029878 tubulin-specific chaperone d Gene [Source:MGI (curated);Acc:Tbcd-001]

 
Come back to gene ENSMUSG00000039230


For any suggestions or comments, please send an email to unitrap@crg.es