Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12079E9
Clone ID IST12079E9
Vector VICTR76
Project tigm

Sequence tag IST12079E9HMF1
Sequence
ATTCAAGCCACAGGTAAGGACTAAGTTAGGGTACAGAGAGAGGAGGAAACCTTGTCGGAGGCTGTGCTTGGGTAAAGTTC
CGCTCTCTCAGGTAGGCAAACGTTTAGAGGAAATTGGGAAATCATTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI30050

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115989527..115989671 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029528 (Pxn) NM_011223 paxillin Gene [Source:MGI (curated);Acc:Pxn-001]


Sequence tag IST12079E9BBF1
Sequence
ATTCAAGCCACAGGTAAGGACTAAGTTAGGGTACAGAGAGAGGAGGAAACCTTGTCGGAGGCTGTGCTTGGGTAAAGTTC
CGCTCTCTCAGGTAGGCAAACGTTTAGAGGAAATTGGGAAATCATTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI30050

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115989527..115989669 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029528 (Pxn) NM_011223 paxillin Gene [Source:MGI (curated);Acc:Pxn-001]

 
Come back to gene ENSMUSG00000029528


For any suggestions or comments, please send an email to unitrap@crg.es