Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10080E6
Clone ID IST10080E6
Vector VICTR75
Project tigm

Sequence tag IST10080E6BBR1
Sequence
CTATAACCAGCACAGCTGCTGTAACCCCATTTACCGCATACTTAACTTTAAACCGGGCACCATGAAGGCACTTTACTTGT
GGTCTTTCATTTGCTTCTCCAAATCCAACAGGGTAGGTGCTAGCACTCACTCAAACTCCAAGAGGTTAAGCAATTTGCCC
AAGGTCACACAGCTAACAAGTAACAAGGTCAAAAATTTCATTTGTTTTGGGCACTTTGCATGTGAGTCTCTGTAAGTAGC
TGACAAGATCC
Sequence Type genomic DNA
Unitrap ID UNI19923

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61391139..61391388 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058806 (Col13a1) NM_007731 collagen, type XIII, alpha 1 Gene [Source:MGI (curated);Acc:Col13a1-005]


Sequence tag IST10080E6BBF1
Sequence
TTAGGAGGCACGACAAAGTGACATCCAATTTCAGAAGCATGTGGCACACTTAGAAAGCTCTTCTCACATACAGGCCACCG
TATGCGATGTTTTATGAACGTTGTCACAGGCGGATGCCAGTGGTGGCTCATTTTACACACAGGGGCTCTGCAGCACAGAG
ATGTTTCCTGCCGGGGCCTCAAGCTAGGGAGGGGCAGGCTGGTCCAGCTGCTGACCACGCTGTGAACTGCCTCTCTGAGG
AGATGCTGAAACTCTGGAACTGCAAACCCAGCAGGCAGGGAGATAAGCAGGCAGGATGGGCCAGGCTGGGCGAGCCCCGG
TTAAAACAGAAAAGACTGATGGCTGTCTCCAGCTCTGGACAGTGGGACACGTTGTGTATGTTCTTCTTGCTTCCTTGGGC
CCCCCGACACTTCCAGGCTGGGGTCAAGAGTGTAAAATCCCAAGTGATGGAATCTCTCGCAGGTCTCACGGGTTGTAGAT
TACGGCTGGATTCTGCAGACTCAGCCAAGGGCAGGCATTTGTTCTCAGGCTGAACAGTTTCCGGCAATAACCCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61391386..61391939 543
 
EST/CDNA Est Name
  BB620629.1

 
Come back to gene BB620629.1


For any suggestions or comments, please send an email to unitrap@crg.es