Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W087B05
Clone ID W087B05
Vector pT1betageo
Project ggtc

Sequence tag W087B05
Sequence
CGGCGCTGGTGCGGGCGAGTTCGGCGGGTGCAGGTCCCGGCCTGCGCCTGCGGAGGGCTCAGGCAGAGGGTCGAAGCGAG
CGGCGCTCGCGACAGACTGCGCTCCGCGATGGTGGGCGTCCCTGGAGCGGCCGCCTTCCAAC
Sequence Type mRNA
Unitrap ID UNI5148

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154262231..154262372 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]

 
Come back to gene ENSMUSG00000038533


For any suggestions or comments, please send an email to unitrap@crg.es