Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W084D01
Clone ID W084D01
Vector pT1betageo
Project ggtc

Sequence tag W084D01
Sequence
GCCNNNCGGCGAGGGCAGNNNNCTGGACATGCATTTCAAGCGCTATCATGATCCCAACTTTGTCCCTGCTGCCTTTGTCT
GTTCCAAGTGTGGGAAAACATTCACCCGCCGGAACACAATGGCAAGACATGCAGATAACTGTGCTGGTCCAGATGGCGTA
GAGGGGGAAAATGGAGGGGAGACAAAGAAGAGCAAACGAGGAAGAAAAAGAAAGATGCGATCTAAAAAAGAAGACTCCTC
TGACAGT
Sequence Type mRNA
Unitrap ID UNI735

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108199989..108201249 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005698 (Ctcf) NM_007794 CCCTC-binding factor Gene [Source:MGI (curated);Acc:Ctcf-001]

 
Come back to gene ENSMUSG00000005698


For any suggestions or comments, please send an email to unitrap@crg.es