Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14636A10
Clone ID IST14636A10
Vector VICTR74
Project tigm

Sequence tag IST14636A10HMR1
Sequence
TTACATTTNANAGATGTGACATGAACAGAGAGGGGTGGCTTCTGGCTTCCAAATTGCACAGCTGGGCCCCTGGGCTGCTG
TGCCTAAGCATGTTACACCTCCACCTTCTTCCTTGGTCTGTTATCTTTGGGGTTCTAACATGGTTTGGGGCTGANATGTT
GGTGCATTGGGAAGTGTCTTGNANATGGTTTTGGGGTCCN
Sequence Type genomic DNA
Unitrap ID UNI18902

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125635077..125635273 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029478 (Ncor2) NM_011424 nuclear receptor co-repressor 2 Gene [Source:MGI (curated);Acc:Ncor2-002]


Sequence tag IST14636A10HMF1
Sequence
TTCACGGTGGTAGAAACCACCTCATAGACATGCCGGAATTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125635273..125635313 41
NO GENE  


Sequence tag IST14636A10BBF1
Sequence
TTCACGGTGGTAGAAACCACCTCATAGACATGCCGGAATTGAGTATATAAGGAGTCTGAACATGCATCCTGCGTGCTCCC
GTGACTGCTGGCTGGCACTGCCAAGACTCAATCCAGAGCTGGCAGCCCAGCTCCAGGCCCTGCACTCCCACACTGCCTGC
CCTGGCAGGCCCCTTAAACCCCAGGCTTGAAGGGGCAGCTGCCGGCGACTCACAGGAGACCGTGCAGTTGCTTCTTTCTG
CCCTGTGTCCTCCTTATGCCTTTGTTTGCCNTGATGCCNCAGGGCTTGGCACTGNNTCCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125635273..125635573 293
 
EST/CDNA Est Name
  BI739750.1 - CJ130493.1 - CJ064744.1 - CJ132535.1 - CJ056642.1

 
Come back to gene BI739750.1 - CJ130493.1 - CJ064744.1 - CJ132535.1 - CJ056642.1


For any suggestions or comments, please send an email to unitrap@crg.es