Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13058E2
Clone ID IST13058E2
Vector VICTR76
Project tigm

Sequence tag IST13058E2HMF1
Sequence
TTGGGACATTTCCAATACTGTGCACACCTAGAGCCTTGGGCCCCCCCTTGCCGTGAATAGTCCTGTATCCTGGTGAGACC
TCTGTGCAGTTTCAGTGTGCTTCTCCTCGGAGGGCATGTTCTTATAGCAAGGAGTAAGAATTCTGTTTTATAGACATGGA
GAAGTCTCAAGATCTGCTGGCTGTATTATTATTATATTATTTTCTTATAGCAAGGAGTAAGAATTCTGTTTTATAGACGT
GGAGAAGTCTCAAGATCTGCTGGCTGTATTATTTTCCTGTTTGCTTGATTTTGCAAAATCAAAGACCAAAGAACAGGACT
GGGGATATGCCTCANAGTTCATCTGGCATGTGTGGCTCCCTGGTTTTGATCCCTAAAGCCNCACATGGTGGTACAAGCCT
ATAACACTAGGACTTGGGAGATAGAGACAGGAAAACCATAAAGTTCAAAATCCTACCTAATCCTTGGCTACATAGTGGGT
TCATGGA
Sequence Type genomic DNA
Unitrap ID UNI10799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106569891..106570375 481
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]


Sequence tag IST13058E2BBF1
Sequence
NTGGGACATTTCCAATACTGTGCACACCTAGAGCCTTGGGCCCCCCCTTGCCGTGAATAGTCCTGTATCCTGGTGAGACC
TCTGTGCAGTTTCAGTGTGCTTCTCCTCGGAGGGCATGTTCTTATAGCAAGGAGTAAGAATTCTGTTTTATAGACATGGA
GAAGTCTCAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI10799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106570201..106570375 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es