Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AZ0168
Clone ID AZ0168
Vector pGT0lxr
Project sanger

Sequence tag AZ0168
Sequence
AAAGCGGTACCAGGACTGGTTCCAGCGCCAGTACCTCTCAACCCCTGACAGTCAGTCTCTGCGCTGTGACCTCATTCGAT
ACATCTGTGGGGTAGTCCACCCCTCTAACGAAGTGCTGAGTTCTGATATCTTGCCTGGTTGGGACATCATTTTCTGGGTC
TTTACAACATGCACGTCCAACGTTGCTGCCTCCAATGCCAAGCTGGCTTTGTTTTATGACTGGCTGTTCTTCAGCCCAGA
AAAGGATAGTATTATGAACATAGAGCCAGCTATCCTGGTCAGGCATCACTCCATGAAGCTCCACCCAGCCATCACTGCCA
CGCTCTTGGACTTCATGTGCCGA
Sequence Type mRNA
Unitrap ID UNI1872

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90207907..90210270 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027933 (Ints3) NM_145540 integrator complex subunit 3 Gene [Source:MGI Symbol;Acc:MGI:2140050]

 
Come back to gene ENSMUSG00000027933


For any suggestions or comments, please send an email to unitrap@crg.es