Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10571F12
Clone ID IST10571F12
Vector VICTR76
Project tigm

Sequence tag IST10571F12BBF1
Sequence
GTTCTCACTCGCCACCTTGTTGGGTCTCGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI33085

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45772574..45772608 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058626 (Capn11) NP_001013789 calpain 11 Gene [Source:MGI (curated);Acc:Capn11-001]

 
Come back to gene ENSMUSG00000058626


For any suggestions or comments, please send an email to unitrap@crg.es