Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12134F3
Clone ID IST12134F3
Vector VICTR76
Project tigm

Sequence tag IST12134F3BBF1
Sequence
TTGCCAAGGTTAGCCTCAAAAATCTGCCTCTCAAATATGGCAATTATAANCACATGCTACCACTCCCAACTTCGATTTGT
TGTTGTTGTTTTTGTTTTTGTTTTGGTTTTGTTTTGTTTTGTTTTGTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI13035

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35963196..35963337 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]

 
Come back to gene ENSMUSG00000022906


For any suggestions or comments, please send an email to unitrap@crg.es