Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13124D2
Clone ID IST13124D2
Vector VICTR76
Project tigm

Sequence tag IST13124D2HMF2
Sequence
CTATCTTTTGTAGCTGTGTTGAAATGGACATGAGTATGTGCAATCACTGTGTTATCATTGTGTCCTTAAAATCCCATCCA
GGCAGAAGAAGAGGTAGGCCTCCACCAATGTGTGTTTCTTTCTGCCATGTTCTAACTGTACAGCCCAAGCAAGTTTATTG
CCAAGCCGTCTTTTTATATTTAGTTTAATTTGTTTTATATGTCTAAGTGTTTCCTCTGTATGTGTGTCTGTGTACCACCC
TGGTGCTAGGAACCAAACCCAGGTCTTCTGCAAGAGTAACAAGTGCCCTTAATGGCTGAGCCACCTTTCCAGCACCCAGA
CCATCTTTTGAAGTCNATTACATATTTATTTG
Sequence Type genomic DNA
Unitrap ID UNI31605

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 144005416..144005767 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074758 (EG433481) predicted gene, EG433481 Gene [Source:MGI Symbol;Acc:MGI:3645019]


Sequence tag IST13124D2BBF1
Sequence
AGTCTTGGGCTTTAGGTGTACTAAGTGTGCATTGCTGAGCTACAGTCACAGCCCAGAAGCTTCTGCGAGTGCTAAGGAGC
TACTGAGGGCGGGCAGTCACCCATTACCAGAAAGCTCTGGGGTGCCACTGCAGGTACCAAAGATAGCAGTGGCCATCCTG
CTTGGGTGAAATCAGTTCTGGAAGCCCAAGCTAAGCAGGCTGCTTTCTGTACGTGATGACAACCTTTTCAGAGTTTGCAC
AGCATTAAAGTCCCAAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74867061..74867321 261
 
EST/CDNA Est Name
  CO815709.1 - AW489600.1

 
Come back to gene CO815709.1 - AW489600.1


For any suggestions or comments, please send an email to unitrap@crg.es