Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A013B04
Clone ID A013B04
Vector pT1betageo
Project ggtc

Sequence tag A013B04
Sequence
GCAGNNNNCNTCGAGAGCAATCATGCANNCCCTGACAGATNNCTCACATCGCAAGGTTAGAGAAAACATGGACGGCTCTG
AGGCACCACTACACGCAGACAGCCATCCTCTATGAGAAGCAGTTGAAGCCCTTTAGCAAAATCCTGCATGAAGGCAGAGA
GTCTACATATGTCCCAGCAAGCAATGTGTCAGTCCCTCTGCTGATGCCACTGGTGACCTTAATGGAACGCCAGGCTGTCA
CTTTTGAAGGGACCGACATGTGGGAAAACAATGACGAGAGCTGTGAAATTCTGCTGAATCACTTGGCAACAGCCAGGTTC
ATGGCTGAGGCTTCTGAGAGCTACAGGATGAATGCTGAGAGGATCCTGGCAG
Sequence Type mRNA
Unitrap ID UNI12350

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 122227839..122228417 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028121 (Bcar3) NM_013867 breast cancer anti-estrogen resistance 3 Gene [Source:MGI Symbol;Acc:MGI:1352501]

 
Come back to gene ENSMUSG00000028121


For any suggestions or comments, please send an email to unitrap@crg.es