Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A024F03
Clone ID A024F03
Vector pT1betageo
Project ggtc

Sequence tag A024F03
Sequence
AGGCGTCGCTCAAGATTCCTCACTGGATGGACCTCCAGGCCCACAAGATGGTACCACAGTTCCTCTGGAGGGGTTCAGCT
TATCCCATGCTGCTGACCTGGTCAACAGGGGTCAGAAGTGGGAGAATTCA
Sequence Type mRNA
Unitrap ID UNI12352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134663194..134663312 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053877 (Srcap) Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]

 
Come back to gene ENSMUSG00000053877


For any suggestions or comments, please send an email to unitrap@crg.es