Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12601G4
Clone ID IST12601G4
Vector VICTR76
Project tigm

Sequence tag IST12601G4BBF1
Sequence
TTGTCTAATTGTANAGGCACACACATCTCTTGTGTTGGTTAGGACTGGCTACAAACTCANAANAATCCAACACTACATCT
CGGTGAAGTGGGTCTTTGCCAATCAACTAGGGTTGCAAAAATCTGTGTCCCATCATTGACAAAGATTATTAAAAGGGGTG
AAAAATAAGCCTGATAAAGTGGCCTTTGTTTCCAAAACTCCTCGTAATGTTGTTANACACTCTTGCCAAATATTCNTAAC
ATATTCTGGCATCAACCTGCTCCTTANTGAGAAAAACGTCCTCTGATCCATCTGACTCATGAACTCCCTTGGAGGGTATT
GTTATCTCCCGAATGCCNAGATTAGGTCCNTCCCGANACACTCTGCCCTTGATGTACCACTCCCTATAACTGTCTGANGG
TCTTANAATGCTTGGGAGTAAAAATGTCACTGTCTGGGGCAATAATCTTCANATATAATTATTACNAAAGACCATGANCC
NACATAAACCTTANATTATANNANNTTGNNCNTGNNNCNNGAN
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84784550..84785049 468
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es