Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12608E11
Clone ID IST12608E11
Vector VICTR76
Project tigm

Sequence tag IST12608E11HMF1
Sequence
ATCCCATGGGTCCCCTCACGCTGCACAGCACATGGGTCTGCACTGGGGTANCAAATCTGATTTGGGATNATGAAAGCCTT
GGCATGCTGCCTGTGGTCTCCTTGGCAACAGTACTGGGTCCTTCTCCCTGGAGTTCCTANACACCCTCCACACCCTCTTT
CTNAACGGCTCTTTGCTTGCGGGGTGGCTGTCCTTTGCTGTGCNANGNNNNTNNTCCTACCTGCGGNAAAAGCTCTCCCT
GCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12608E11BBF1
Sequence
ATCCCATGGGTCCCCTCACGCTGCACAGCACATGGGTCTGCACTGGGGTANCAAATCTGT
Sequence Type genomic DNA
Unitrap ID UNI26154

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84366152..84366210 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020037 (Rfx4) NM_027689 regulatory factor X, 4 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:1918387]

 
Come back to gene ENSMUSG00000020037


For any suggestions or comments, please send an email to unitrap@crg.es