Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10361B1
Clone ID IST10361B1
Vector VICTR76
Project tigm

Sequence tag IST10361B1HMF2
Sequence
NCAGCAGGTGTGACAAANNCCCCCAGTCTCCATGAATGACTTANATACTTTTGTATCCAAGCACGGTGTGCTGGTCTATC
GTCAAGCTTGGTGGAATCCGGTAATGTTA
Sequence Type genomic DNA
Unitrap ID UNI17054

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94005897..94006003 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047109 (Cldn14) NM_019500 claudin 14 Gene [Source:MGI (curated);Acc:Cldn14-001]


Sequence tag IST10361B1BBF1
Sequence
TTGTGTATAGCTGACATCTTCTCTCCCCTCTGAGAAATTCTGATGGCTCACTGGTACGGCCAGAACACGCTCTTTCCTAA
TATGCCCCAAGCCTCCAGCCCATTCTTGCCTTCTGTTCTGCCCCTGAACTCCCAAGGACTTTGAATTATCATGCCACTAT
TCCTGTCACATGCCATTCCCATGAAATGCCACTGCTTCTTANCAAGTCTGTTCTGGGCTGCACAGGCGGTTATATTTATC
TCTAGTTAGACATCCTTTGGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 128600888..128601151 262
NO GENE  

 
Come back to gene ENSMUSG00000047109


For any suggestions or comments, please send an email to unitrap@crg.es