Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14412D10
Clone ID IST14412D10
Vector VICTR74
Project tigm

Sequence tag IST14412D10HMR1
Sequence
ATTTCTATCTAGCAAGCCCCGGGGCATTAAAACACACCACAGGAGCAGGCAGGAGAGATCAAAGATACATCATCATCAGA
TCTCCTGAGTTAGCCCTCTAGAGTCCCTAACACTTTAGTCTTCTAAGATAGCCTCAAAGCTGCAGAGCTCANTTCTGTAG
ACGTGGAAGAAGGCCCGATCCTCCCTGACTCACCTGTAGCATGTGGGACACATCNNANAGAGANCNNTGCCGGCGTGTGT
GCNGGTGTGAATNNNNNNGANNGTNACGGTATTGTNCANGCNNACTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14412D10BBF1
Sequence
AAATTGGTTTGGTATCTCAGTAAGGTGTTAGATCGCCTTGAATTTTTAGATGTTGCTTGGTTGCACGGAGGCTGGGAGGG
ATCT
Sequence Type genomic DNA
Unitrap ID UNI25498

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108199816..108199898 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032607 (Amt) NM_001013814 aminomethyltransferase Gene [Source:MGI Symbol;Acc:MGI:3646700]

 
Come back to gene ENSMUSG00000032607


For any suggestions or comments, please send an email to unitrap@crg.es