Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12086A10
Clone ID IST12086A10
Vector VICTR76
Project tigm

Sequence tag IST12086A10HMF2
Sequence
CTCTTACCCACTGAGCCATCTCACCAGCCCTCC
Sequence Type genomic DNA
Unitrap ID UNI950 UNI5980 UNI15223 UNI33049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 247175..247207 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 45359761..45359793 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 14261885..14261917 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17066960..17066992 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31413606..31413638 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 6568802..6568834 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 58400082..58400114 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 74363134..74363166 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021103 (Mnat1) NP_032638 menage a trois 1 Gene [Source:MGI Symbol;Acc:MGI:106207]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69515901..69515933 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 9306750..9306782 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21738353..21738385 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6071211..6071243 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 23485398..23485430 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 37765748..37765780 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 17126493..17126525 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058230 (Grlf1) NM_172739 glucocorticoid receptor DNA binding factor 1 Gene [Source:MGI Symbol;Acc:MGI:1929494]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 8007799..8007831 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41215927..41215959 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 40880319..40880351 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049940 (Pgrmc2) progesterone receptor membrane component 2 Gene [Source:MGI (curated);Acc:Pgrmc2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 21049475..21049507 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31536649..31536681 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 47225311..47225343 33
NO GENE  


Sequence tag IST12086A10BBF1
Sequence
CTCTTACCCGCTGAGCCATCTCACCAGCCCTCCCCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 22193106..22193140 35
NO GENE  

 
Come back to gene ENSMUSG00000049940


For any suggestions or comments, please send an email to unitrap@crg.es