Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14802C3
Clone ID IST14802C3
Vector VICTR76
Project tigm

Sequence tag IST14802C3HMF2
Sequence
AGAGCACAAGTCCAAAGGCACCCAGAGCCAAAGAGGGTGGGCGAGGACCGGGAGAGGGAGCGGCGAGTTCTGATGAGAGA
TTTTCATGGAGCCACATCCTCACCTTGTGGCTCCTTAACAAACTGCACGGACTACTTGTGTGTGTGGTGTGTTCTTACTG
ATCCTTGTTTGGTTCATCAAGAGCCGGGTTCTGGACTTGACTCCTTANCACGCACACNANTCGGGAAGGGANGANAANCT
GGCTGCATGAAANGACNTGTANTANAAATGTGTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20144992..20145266 255
 
EST/CDNA Est Name
  BY100685.1 - BY768401.1 - BY222624.1 - BY220521.1 - BY072019.1 - BY219945.1 - BY016259.1 - AA144251.1 - BY220153.1 - AW762482.1 - BY219839.1 - BY263615.1 - BY788608.1 - BY127754.1 - BY035784.1 - BY177167.1


Sequence tag IST14802C3HMR1
Sequence
TCTTACTGATCCTTGTTTGGTTNATCAAGAGCTGGGTCCTAGACTTGGCTCCTTAGCACGCAGACGACTGTAGATGTGAG
GTGTGAGAGGGGTCCANCTTCATGTGTCTCCCCGTTC
Sequence Type genomic DNA
Unitrap ID UNI23572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20144879..20144994 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044066 (Cep68) NM_172260 centrosomal protein 68 Gene [Source:MGI (curated);Acc:Cep68-001]

 
Come back to gene ENSMUSG00000044066


For any suggestions or comments, please send an email to unitrap@crg.es