Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M050A08
Clone ID M050A08
Vector U3betageo
Project ggtc

Sequence tag M050A08
Sequence
TCCCCCCAGCTCTGGAGAGTCGGCTCTGCGTCGTGCCGCCATGATGGGCCACCGTCCAGTGCTCGTGCTCAGTCAGAACA
CAAAGCGTGAATCTGGAAGAAAAGTTCAGTCTGGAAATATCAATGCTGCAAAGGTAGTGCATGTTTTATGAGATAACAGC
AGTTTGTTC
Sequence Type mRNA
Unitrap ID UNI12357

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88101118..88103361 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001416 (Cct3) NM_009836 chaperonin containing Tcp1, subunit 3 (gamma) Gene [Source:MGI Symbol;Acc:MGI:104708]

 
Come back to gene ENSMUSG00000001416


For any suggestions or comments, please send an email to unitrap@crg.es