Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W054B02
Clone ID W054B02
Vector pT1ATGbetageo
Project ggtc

Sequence tag W054B02
Sequence
CACCTCATGTGGTCAAAGTGCCAGCGTCACAGNNNCGTCCAGAATCTAAACCTGACTCTCAGATCCCACCACAAAGGCCT
CAGAGAGATCAGAGAGTTCGAGAGCAGCGAATCAATATCCCTCCTCAGAGAGGACCCCGACCAATCCGTGAGGCTGGTGA
ACCAGCACGATGTGGAACCTGGAAGGATGGTGAGGCACCGTGACAGTCGCCAGCTCTTCAATGGGAACCTGCACCCATCA
GGTTGCCTAGTCGCATCTNNACATGCGCATGTCACCCAG
Sequence Type mRNA
Unitrap ID UNI12360

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 55309716..55311526 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018583 (G3bp1) NM_013716 Ras-GTPase-activating protein SH3-domain binding protein 1 Gene [Source:MGI (curated);Acc:G3bp1-001]

 
Come back to gene ENSMUSG00000018583


For any suggestions or comments, please send an email to unitrap@crg.es