Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12594E1
Clone ID IST12594E1
Vector VICTR76
Project tigm

Sequence tag IST12594E1HMF1
Sequence
TCCAGGGGTGGGAAAAGGCGCAGTCTAGGGTCCCCCAAGAACCTGCCAGAGTCGGCGTCCAACTCTTGGGCACCACAGAC
CACTGAGCACCATGGAAGAGCCGGTTCTGGGGTCCCTGGGCAGCACGGAGGCAGCAGGCTCTCATTCTCAGACATCCCAN
ATGCTGCTGGAAGAGCTGAGAACAAAGTGGGGACCCTCGGGCAGACTCTGGCCGAGGTGGGGGTGGGGGCAAAGTGAAGG
CAGAGGAGTCCTGCTAGCCCAGGCGGCTTGCTCTGCGGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI14116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8886725..8887006 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025277 (Abhd6) NM_025341 abhydrolase domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1913332]


Sequence tag IST12594E1BBF1
Sequence
TCCAGGGGTGGGAAAAGGCGCAGTCTAGGGTCCCCCAAGAACCTGCCAGAGTCGGCGTCCAACTCTTGGGCACCACAGAC
CACTGAGCACCATGGAAGAGCCGGTTCTGGG
Sequence Type genomic DNA
Unitrap ID UNI14116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8886725..8886835 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025277 (Abhd6) NM_025341 abhydrolase domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1913332]

 
Come back to gene ENSMUSG00000025277


For any suggestions or comments, please send an email to unitrap@crg.es