Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15032C10
Clone ID IST15032C10
Vector VICTR78
Project tigm

Sequence tag IST15032C10HMF1
Sequence
TGTTCTCCTGTATTTCTTTAAGTGATTTATTAAAGTCCTTCTTGATGTCCTCTACCATCATCATGAGATATGCTTTTAAA
TCTAGGTCTAGGTTCTCAGGTGTGTTGGGGTTCCCTGGACTGGGCGAAGTGGGTGTGCTGGGTTCTGGTGATGGTGANTN
Sequence Type genomic DNA
Unitrap ID UNI15225 UNI29644 UNI30806 UNI30807 UNI30808 UNI30809

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166309: 114887..115043 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 48416..48572 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 134326..134482 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 20647326..20647482 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10880940..10881096 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11691886..11692042 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14814761..14814917 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4369413..4369569 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049148 (Plcxd3) NM_177355 phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI (curated);Acc:Plcxd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 4073926..4074082 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033715 (Akr1c14) NM_134072 aldo-keto reductase family 1, member C14 Gene [Source:MGI (curated);Acc:Akr1c14-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9689454..9689610 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7826233..7826389 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4770937..4771093 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3176509..3176665 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5255373..5255529 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019769 (Syne1) NM_022027 synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3912641..3912797 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3770225..3770381 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110230..5110386 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3987032..3987188 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5641302..5641458 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049119 (1700012H17Rik) NM_173426 family with sequence similarity 110, member B Gene [Source:MGI Symbol;Acc:MGI:1916593]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 4169693..4169849 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4906132..4906288 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7842927..7843083 157
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7324237..7324393 157
NO GENE  


Sequence tag IST15032C10HMR1
Sequence
ANNAAATAAGAATATATATAAATATATATATAATATTCTGAAAACTCTTACTTGTNAGGGGACTTAAATCCGGTCANGCA
NCATAATGCTTAAATTCCTTCATATGGCTCCTTAATTTCAACCCCAGGATGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 52682111..52682240 124
NO GENE  

 
Come back to gene ENSMUSG00000049119


For any suggestions or comments, please send an email to unitrap@crg.es