Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14153F3
Clone ID IST14153F3
Vector VICTR74
Project tigm

Sequence tag IST14153F3BBF1
Sequence
ATCCCAAAGTCCTGCTAATCTCTTCATCACCTGCAAAGTTATGATATCCAGCTAGCACAAGCATCTTACAGACATCTGTG
TGTTAGGCTTTATTGAAAACAAACTCCCCATTGAAGTATGCAATCTAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102832435..102832566 132
 
EST/CDNA Est Name
  EH111633.1


Sequence tag IST14153F3HMR1
Sequence
GGGATAATTTGGGGTCTTTGCAGAGGATGTAGGCNATCCTCACTTGAGCACTCAAGAGTGAACAGTTTCAAGTACTTGCA
TCACTGGATCCTTCCC
Sequence Type genomic DNA
Unitrap ID UNI7671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102832562..102832656 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]

 
Come back to gene ENSMUSG00000068823


For any suggestions or comments, please send an email to unitrap@crg.es