Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12659B8
Clone ID IST12659B8
Vector VICTR76
Project tigm

Sequence tag IST12659B8BBF1
Sequence
TTTTANACCTTAAACTGTANAATTAGAATTAGGGAGGTCAGTGTAACTTGACTGAGGGACAGACTAGAAGTCAGTGTAGC
TGAACAAAGAGTAATGGGAGAGAACGTGGGTCANAATTGGATGTGGTTTTAGTATACATTACCTATAAGCCCAGTTACTG
GCTNAGGAGTCTGAGGTAGGAAGATCAAGGCTGGGCTATGACCCTATCTCTAANATCCCCCTCCCCCAAAGCAAGTTGGG
GTTGGAGAAGCCNGGTATGATGGTGCATTCCTGCANTGCCNAAGTGCTTGGAAGACAATATGTAGGGAGATCAGGGGTTC
AAGGCCNNCTTCANCTACNTGANACCTTATCTCAAAACAAAATANAATN
Sequence Type genomic DNA
Unitrap ID UNI23659

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123495273..123495639 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029477 (Morn3) NM_029112 MORN repeat containing 3 Gene [Source:MGI (curated);Acc:Morn3-002]

 
Come back to gene ENSMUSG00000029477


For any suggestions or comments, please send an email to unitrap@crg.es