Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0799
Clone ID AY0799
Vector pGT0lxr
Project sanger

Sequence tag AY0799
Sequence
CGCGCCCCACCACGGCGTGGAGCCTAGATCCACGTAACTTTGGCGGCCCGGGAAGACTACACACCTCTTTCATGGCTTCG
GCGAACACCCGGCGAGTTGGCGATGGCGCCGGTGGCGCCTTCCAGCCTTACCTCGACTCCTTACGACAGGAGCTGCAGCA
GAGGGATCCGACGCTGCTCTCCGTGGCGGTGGCTCTCCTGGCGGTGCTGCTGACGCTGGTGTTCTGGAAGTTCATCTGGA
GCCGAAAGAGCAGTCAGAGAGCTGTTCTCTTCGTTGGTCTCTGTGACTCTGGGAAAACGTTGCTGTTTGTCAGG
Sequence Type mRNA
Unitrap ID UNI1880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103103617..103104460 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032553 (Srprb) NM_009275 signal recognition particle receptor, B subunit Gene [Source:MGI Symbol;Acc:MGI:102964]

 
Come back to gene ENSMUSG00000032553


For any suggestions or comments, please send an email to unitrap@crg.es