Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11063C4
Clone ID IST11063C4
Vector VICTR76
Project tigm

Sequence tag IST11063C4HMF1
Sequence
GATTCNAAAAGCCCAAGTTACTTCTANAACAGTATCCCACCAGGCCGCACATTGCAGGTAGGGCGGCTGGTTCATCGTGC
CCTCTTGGGGCTTGATCCTGTCCAGTTCATGATGAAAATAAGTAGCGATTTGGATATAAGGAAGTTCTGGAGACATACCA
TACCTTTANACAAAGTAGTTTTCTGACACTGCAGCGTANACACTCCGAACCCAACCACTCATTTTACTGTTTTTTCTGAG
TGTCCATTAGCATTATCANACAGCTTGTTTGTTTGTTTGTTTGTTTGTTTCTCTCAACACACTGTAAATTCTCAGGAGCA
AGGAATTTGTTAGTCTTTTCGGTGTCTAGAGAGTCATGTACTAGTTAGGAGCTCATTAAACATTTGCTTAATACAGATAA
CTTCGTACTGAAGTCAAGGACATGTATTTCCCGTGTTACGTATTTCTGCCCTANAGACANATACTAGAAATCGAGTTTCA
NNTTGTGGACAGTTGANGAAGCGTTTCTTCACAAATGANCTCTTGCTTGGTGCCNGANNNNGATACTGANAATGTN

Sequence Type genomic DNA
Unitrap ID UNI24703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69722808..69723362 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051730 (Mettl5) NM_029280 methyltransferase like 5 Gene [Source:MGI (curated);Acc:Mettl5-001]


Sequence tag IST11063C4BBF1
Sequence
GATTCGAAAAGCCCAAGTTACTTCTAGAACAGTATCCCACCAGGCCGCACATTGCAGGTAGGGCGGCTGGTTCATCGTGC
CCTCTTGGGGCTTGATCCTGTCCAGTTCATGATGAAAATAAGTAGCGATTTGGATATAAGGAAGTTCTGGAGACATACCA
TACCTTTAGACAAAGTAGTTTTCTGACACTGCAGCGTANACACTCCGAACCCAACCACTCATTTTACTGTTTTTTCTGAG
TGTCCATTAGCATTATCAGACAGCTTGTTTGTTTGTTTGTTTGTTTGTTTCTCTCAACACACTGTAAATTCTCAGGAGCA
AGGAATTTGTTAGTCTTTTCGGTGTCTAGAGAGTCATGTACTAGTTAGGAGCTCATTAAACATTTGCTTAATACAGATAA
CTTCGTACTGAAGTCAAGGACATGTATTTCCCGTGTTACGTATTTCTGCCCTANNGACAAATACTAGAAATCGAGTTTTN
NNGTTGTGGACAGTTGAGGAAGCGNTTCTTTCACAAATGACCTCTTGCTTN
Sequence Type genomic DNA
Unitrap ID UNI24703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69722835..69723362 508
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051730 (Mettl5) NM_029280 methyltransferase like 5 Gene [Source:MGI (curated);Acc:Mettl5-001]

 
Come back to gene ENSMUSG00000051730


For any suggestions or comments, please send an email to unitrap@crg.es