Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13733F11
Clone ID IST13733F11
Vector VICTR74
Project tigm

Sequence tag IST13733F11HMF2
Sequence
TTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGAGTCAGATCTTGTTACGGATGGTTGTGAGCCACCATGTGGTTG
CTGGGATTTGAACTCTGGACCTTTGNAANANCANTCGGGTGCNCNTC
Sequence Type genomic DNA
Unitrap ID UNI14797 UNI21903 UNI26423 UNI33100 UNI33101 UNI33102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 41963813..41963933 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035049 (Rrp12) NM_199447 ribosomal RNA processing 12 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2147437]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15686500..15686620 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051977 (Prdm9) PR domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:2384854]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 23162538..23162658 113
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 77359107..77359227 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021048 (Mthfd1) NM_138745 methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase Gene [Source:MGI Symbol;Acc:MGI:1342005]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93919998..93920118 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020859 (Spag9) NM_027569 sperm associated antigen 9 Gene [Source:MGI (curated);Acc:Spag9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106161782..106161902 113
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 58498940..58499060 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021969 (Zdhhc20) NM_029492 zinc finger, DHHC domain containing 20 Gene [Source:MGI Symbol;Acc:MGI:1923215]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79676833..79676953 113
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122849936..122850056 113
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52254439..52254559 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003184 (Irf3) NM_016849 interferon regulatory factor 3 Gene [Source:MGI (curated);Acc:Irf3-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 114943766..114943886 113
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41245018..41245138 113
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 147474503..147474623 113
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 156487539..156487659 113
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9764057..9764177 113
NO GENE  


Sequence tag IST13733F11BBF1
Sequence
TTACACTGTAGCTGTCTTCAGACACACCANAANAGGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000003184


For any suggestions or comments, please send an email to unitrap@crg.es