Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14855B6
Clone ID IST14855B6
Vector VICTR76
Project tigm

Sequence tag IST14855B6HMF1
Sequence
CATCCACAGACAGCCTCACGTTTTTCTCCTACTTTTTCCTTATGCTTTTAAATGGCAGANTCGCCGGGCGTGGTGGCGCA
CGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTC
CAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATA
AATAAATAGCAGACTCTGAATTGGTCAGTCTAAATTCTTTT
Sequence Type genomic DNA
Unitrap ID UNI30776

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 42567724..42567938 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067285 (EG433882) predicted gene, EG433882 Gene [Source:MGI Symbol;Acc:MGI:3648966]

 
Come back to gene ENSMUSG00000067285


For any suggestions or comments, please send an email to unitrap@crg.es