Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14522B9
Clone ID IST14522B9
Vector VICTR74
Project tigm

Sequence tag IST14522B9HMR1
Sequence
GGAACATGATCGGCTCCGGCATCTTTGTCTCCCCTAAGGGTGTGCTCATGTACAGTGCCTCTTTTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI23040

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55027628..55027696 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000958 (Slc7a7) NM_011405 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symbol;Acc:MGI:1337120]


Sequence tag IST14522B9HMF1
Sequence
TTCCCCACTATGAGACACACGCCATTAAGCAGGGAGATCTCCTTCTTCAGTTTGACCTGCTCCGCCACTGGGCTGGCCCC
ATCCCCGAGAGCAGAGCCATCGTCGGCCTCGTGCTGAGCAGCCACTTCATACTTGGTGCTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55027693..55027835 143
 
EST/CDNA Est Name
  CD563845.1

 
Come back to gene CD563845.1


For any suggestions or comments, please send an email to unitrap@crg.es