Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14904D1
Clone ID IST14904D1
Vector VICTR76
Project tigm

Sequence tag IST14904D1HMR1
Sequence
NTGAAGATCCGAGATTGAGCTGAAAATCCCTTGAAGGGATTATTTGAAAATACCAACATGTAGTTTGGGTGAAAATGGAA
GAATTCGGTGACGCAAACAGTAAAGGTTTTTATAATAATAATCTAGTCTTCAAGGCAAGCTAGGAGTCGTGTTTAGTTTC
AGGTCTAGGAGGTGGGTTTCCGGGANGCCCTGGGGANACCNCNGGCN
Sequence Type genomic DNA
Unitrap ID UNI29874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22432411..22432615 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


Sequence tag IST14904D1HMF1
Sequence
CAAGTAACACCTTAGGAACAATGGATTATTATGGGGTGGTGGGCACTGCCAGAACTCCCAGGCTCTAGAGCAGCCGTTCT
CAACCTGTGGGTCACAACCCCTTTTAGGGGGAGGTCACATACCACATAGCCTCCATATCANATATTACATCACAGTTCAA
GACAGTAGTAAAATTACAGTTACNAAGTANCANCAAAATGATGGGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22432614..22432825 201
 
EST/CDNA Est Name
  CK389430.1

 
Come back to gene CK389430.1


For any suggestions or comments, please send an email to unitrap@crg.es