Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W072E08
Clone ID W072E08
Vector pT1betageo
Project ggtc

Sequence tag W072E08
Sequence
GGGGGCGGTTATCTTGGTAGCCAATGCAATCGTGGGTGTGTGGCAGGAAAGAAATGCTGAAAATGCAATNNNAGCTCTTA
AGGAATATGAGCCTTAAATGGGCAAAGTGTAGGGGCAGGACAGAAAGAGTGTGCAACGAATTAAAGCTAAAGACATAGTT
CCTGGTGATATAGTGGAAATTGCTG
Sequence Type mRNA
Unitrap ID UNI3831

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122939247..122941727 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029467 (Atp2a2) NP_001103610 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 Gene [Source:MGI Symbol;Acc:MGI:88110]

 
Come back to gene ENSMUSG00000029467


For any suggestions or comments, please send an email to unitrap@crg.es