Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0688
Clone ID AY0688
Vector pGT0lxr
Project sanger

Sequence tag AY0688
Sequence
AAGAAGCCAAAATCATCGCTATGACATGTACTCATGCTGCCTGAAACGACACGACTTGGTCAAGTTGGGTTTCAAGTATG
ACAACATTTTAATGGAAGAGGCTGCTCAGATTCTGGAGATCGAAACCTTTATCCCTCTACTTCTGCAGAATCCTCAAGAC
GGATTCAGCCGATTGAAACGGTGGATTATGATTGGCGATCACCACCAATTGCCTCCAGTCATTTTGAACAGGGCCTTCAG
AAGGGTCCAACATGGAGCAGTCTCTTTTCACTCGCTTCGTCCGGGTTGGAGTTCCTACTGTGGACCTTGATGCTCAAGGG
AGAGCCAGGGCAAGCTTGTGTAACCTCTACAACTGGCGCTACAAAAACCTAGGGAATTTGCCCCATGTGCAGCTCCTGCC
AGAGTTCAGCACAGCCAACGCGGGCCTGCTGTATGACTTCCAGCTCATCAACGTGGAAGACTTTCAGAGGCGTGGGAGAG
TCGGAGCCTAACCCTTACTTCTACCAG
Sequence Type mRNA
Unitrap ID UNI1884

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 113938218..113942335 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040383 (Aqr) NM_009702 aquarius Gene [Source:MGI (curated);Acc:Aqr-001]

 
Come back to gene ENSMUSG00000040383


For any suggestions or comments, please send an email to unitrap@crg.es