Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15058D6
Clone ID IST15058D6
Vector VICTR80
Project tigm

Sequence tag IST15058D6HMR1
Sequence
TTGAACTCATAGCGATCCACCTGCCTCTGTCTCCTTAGTGCTGGGATTATCTGGCACCAAGGAGAGTCCTCTGCATACTG
GAGCCTGCTGCCCTAGGTGTTGCTCTGAAGCCCCAAGAAGCCATCTCTTTCTCTAAATGTGGGGAGTCTTCTGTGTAGTT
GATTGATCATGAACCCCACAGTGTATGAAGTGAAAGTCAGAGTGGTTACGATGGCCTGGGACAGGTGGGCTGGAGCCTTG
CGCTCACAGTTTGTCCTCCTGCTCCTGGATGTGCACAGACTTACGTGACACCTGAGCGGCTTTCACTTGGGAGCTGTCAG
GAAATCCTTACTACCTGCTACCAAACAGACTGAGCACTTCTTTATTTATAGGGACATCGTTACCCANGCTTTAAGCTTCA
AGANGGCGGCAGCCCTCTACCAGCTTGTGCTCANANTN
Sequence Type genomic DNA
Unitrap ID UNI27213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 32116477..32116909 429
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020282 (Rhbdf1) NM_010117 rhomboid family 1 (Drosophila) Gene [Source:MGI (curated);Acc:Rhbdf1-006]


Sequence tag IST15058D6BBF1
Sequence
AGTTAAGACCTTGTTAACAAAACAAAACAAAACAAAACAAAACAAAACTCCCTTGGAGCAGAAGCCACAATAAATGACCA
CGAGGTGGCGCCAACTGCCAAAAAAGGCATCGAGGCAGGGACAGGTTGAGGAACCCTGAATACCTAAGACCAAACAGAGT
GTAGTACACCAGCTGGCCCGCCAGACAGATCAGAAGGAAAAAGCGCTTGTTCCCTATTCAAGCCTGAGTTCCCTGGAAAT
CACAAAGGGTGGAAAAGAAAACTGAATCCATAAAGTAGTCTTCCGGCTTCTGATTAGATAGATAGATGATAGATAGATAG
ATAGATAGATAGATAGCCTGGCTTGGTAGTACATGCCTTTAATACCTGCCCTTGGGAGGCAGANGCAGGCTTCTGTGANT
CCAAGGCCNGCCTGGCCTACACAGTGAGTTCCAGGACAGCCAGANTTATACACTGACACCCTGTCNTGAAAGAAACATTA
TATATATTTCACACACACNCNCNCNCNCNCNCACACNTTTGANCCNNGCNTANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 32116955..32117486 498
 
EST/CDNA Est Name
  AA530044.1 - AA727774.1 - BI647302.1 - BY733688.1 - BI645686.1 - BY719527.1 - BF135368.1 - CF169959.1 - CJ098616.1 - CJ098599.1 - CK019604.1 - CJ099658.1 - BB866582.1 - CJ100162.1 - BY243086.1 - BY770225.1 - BY270878.1 - BY008788.1 - BY332847.1 - BY766909

 
Come back to gene AA530044.1 - AA727774.1 - BI647302.1 - BY733688.1 - BI645686.1 - BY719527.1 - BF135368.1 - CF169959.1 - CJ098616.1 - CJ098599.1 - CK019604.1 - CJ099658.1 - BB866582.1 - CJ100162.1 - BY243086.1 - BY770225.1 - BY270878.1 - BY008788.1 - BY332847.1 - BY766909


For any suggestions or comments, please send an email to unitrap@crg.es